![]() T he used primers were GAPDH sense 5′TATGATGACATCAAGAAGGTGG'3, GAPDH antise nse 5′ CACCACCCTGGTGCTGTA'3 β 2 -integrin sense 5′TG CGCCCCTCACTGCTGCTTG 3′ β 2 -integrin antisense 5′GAGATCCAT GAGGTAGTACAGATC 3′ and VCAM-1 ant isense 5′ ACCGTGCAGTTGACATGAC 3′. Other Sequences in this article (fasta format) One row per sequence, with flanking text, sequence in bold NO inactivation of the CD40–CD40L system, both important processes of the inflammatory response.Ĭopyright 2012 Elsevier B.V.In conclusion, LNO 2 inhibited adhesion molecules expression and promoted Moreover, 2-(4-carboxyphenyl)-4,4,5,5-tetramethylimidazoline-1-oxyl-3-oxide, a nitric oxide scavenger, partially abolished the inhibitory action of LNO 2 on leukocyte-endothelium interaction, suggesting that the antiadhesion effects of LNO 2 involve a dual role in leukocyte adhesion, acting as a nitric oxide donor as well as through nitric oxide-independent mechanisms. In addition to this, LNO 2 reduced mRNA and protein expression of β2-integrin in circulating leukocytes, as well as VCAM-1 in endothelial cells isolated from postcapillary venules, confirming its antiadhesive effects on both cell types. ![]() LNO 2 decreased the number of adhered leukocytes in postcapillary venules of the mesentery network. Other anti-inflammatory actions of LNO 2 were observed in vivo by intravital microscopy assays. THP-1 monocytes incubated with LNO 2 for 5 min presented nitrosation of CD40, leading to its inactivation. NO) into cells, 5 min after its administration to cultured cells, with a peak of liberation at 30 min.Confocal microscopy analysis demonstrated that LNO 2 was capable to deliver free radical nitric oxide ( The vascular effects of nitrolinoleate (LNO 2), an endogenous product of linoleic acid (LA) nitration by nitric oxide-derived species and a potential nitrosating agent, were investigated on rat endothelial-leukocyte interactions. The Journal of Nutritional Biochemistry 2010, Vol 21, Issue 2,, PMID19195864 Bioactivity of nitrolinoleate: effects on adhesion molecules and CD40–CD40L system
0 Comments
Leave a Reply. |
AuthorWrite something about yourself. No need to be fancy, just an overview. ArchivesCategories |